Dataset for CDS PMAIP1 of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2NWG2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pongo abelii GN=PMAIP1 (length=165 residues).
atgcctggaaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccggcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
© 1998-2018