Dataset for CDS HRK of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2NIS8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pongo abelii GN=HRK (length=276 residues).
atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctcccaacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018