Dataset for CDS classical BH3-containing proteins of organism Pongo abelii

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A2J8T301_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pongo abelii GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggggacccaatccgg
aagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcctactggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacaggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|H2NIS8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pongo abelii GN=HRK (length=276 residues).
atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctcccaacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2NWG2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pongo abelii GN=PMAIP1 (length=165 residues).
atgcctggaaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccggcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|H2NZD3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pongo abelii GN=BBC3 (length=582 residues).
atggcccgcgcacggcaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|H2P4N6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pongo abelii GN=BIK (length=378 residues).
atgtctgaagtaagacctatctccagagacatcctgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcagtcctttggagtgcatggagggca
gtgacgcgttggccttgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgccgggcccagctc
cccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
cacggacggtttcaccacccttaaggaaaacataatgaggttctggagctccctgtaa
>gnl|bcl2dbcds|H2P5E2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pongo abelii GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tatggagaatgcattga
© 1998-2018