Dataset for CDS BIK of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2P4N6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pongo abelii GN=BIK (length=378 residues).
atgtctgaagtaagacctatctccagagacatcctgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcagtcctttggagtgcatggagggca
gtgacgcgttggccttgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgccgggcccagctc
cccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
cacggacggtttcaccacccttaaggaaaacataatgaggttctggagctccctgtaa
© 1998-2018