Dataset for CDS BCL2L11 of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2P5E2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pongo abelii GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tatggagaatgcattga
© 1998-2019