Dataset for CDS classical BH3-containing proteins of organism Poecilia reticulata

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3P9N073_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L11 (length=609 residues).
gacccagcatcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccac
agccgggggaggaggaggaggaggaagaggggagccggactcggactcgccgccgtgcaccgtgagcccggccagtttag
acgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgctg
ccgagctccccgctctctccgcacccagtgacggctgacaaaaccacgcagacccccagccccaccggccaggtgatgaa
ccacgccctgcagcgaatggctgtggagcacgaaattcccaagctcaatgtgaaaggaaaagaggaaaaagggggaagag
gaggggcattcgtcattataccaaaaagagaaacaaaccaacccattttgtcttgtgtcctcccagtgcaactgatgatt
cagcagttttctcatgcgacttccatcggtataaaaaaaagaaaaagagtaggatatgatgatgattattatcattacta
catagattgtttctttttaaaatcagtaagtaaatacgacgtggcatag
>gnl|bcl2dbcds|A0A3P9Q7C3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia reticulata GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactctgagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggacccca
actgagggctttccattcagggtccggtctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtgccgggtcgaacggac
cgatccaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3P9Q8E2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia reticulata GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtcctggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gattattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcagggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcttgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgtatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
© 1998-2019