Dataset for CDS BAD of organism Poecilia reticulata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P9Q7C3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia reticulata GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactctgagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggacccca
actgagggctttccattcagggtccggtctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtgccgggtcgaacggac
cgatccaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
© 1998-2019