Dataset for CDS BMF of organism Poecilia mexicana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3WU80_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia mexicana GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtccgggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtaccaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttcatagggggtttattgctggaggaggtggagcaggacggagg
tga
© 1998-2019