Dataset for CDS BCL2L11 of organism Poecilia mexicana

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B3YII5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L11 (length=726 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggagggggaggaggaggaagaggggagccggattcggactcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
gaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccacacatccagcaagagcctgttgccatgc
tttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccactctcag
gtttag
>gnl|bcl2dbcds|A0A3B3YII5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L11 (length=726 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggagggggaggaggaggaagaggggagccggattcggactcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
gaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccacacatccagcaagagcctgttgccatgc
tttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccactctcag
gtttag
© 1998-2019