Dataset for CDS BCL2L11 of organism Poecilia latipinna

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3VNE0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L11 (length=732 residues).
atgcactcttcaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcagacgggcgcctccacagccgggg
gaggaggaggaggaggagggggaggaggaggggagccggacgcggattcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgataaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaacctttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
ggtaaggaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccgcacatccagcaagagcctgttg
ccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccac
tctcaggtttag
© 1998-2019