Dataset for CDS classical BH3-containing proteins of organism Poecilia formosa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A087X8P8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia formosa GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtatggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A096LRV0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia formosa GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtccgggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtaccaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttcatagggggtttattgctggaggaggtggagcaggacggagg
tga
© 1998-2018