Dataset for CDS BMF of organism Paramormyrops kingsleyae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3RH63_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BMF (length=441 residues).
atggacgatgacgatgacgatgtgttccacacggacccgctcacctatcagcccccgttcagggatataaagtgtgagaa
tcggggcacgcagacgcccggcccagccctggtgcagggcctcaacatgctgccctgtggcgtgggccaagagccacgca
gactcttctacggtagtgcaggcttgcggctgcatttcccggcactttcggtgcccggcgggcacccgccgcaggaggag
cggcagcccgacgaccgcccgcaaccgagcgccgaggtccggattggccagaagcttcagatgattggagaccagtttca
ccaagaccaactccagttgtaccacagaaaccaaaggaatcagcagccggtgtggtggcggcttgtgatggcgctgtgtg
gcctcctcttcgagaggcgccaaagagcagagcagagatga
© 1998-2019