Dataset for CDS BCL2L11 of organism Paramormyrops kingsleyae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3QC78_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L11 (length=573 residues).
atgggacaaattctattaacgatcccctgctctgtctgttctgcagaggacaaaatcacacgaatggcggagagtcgcaa
cccagtggcggaacagactccgatccaagccggtccgagaaccgccaaggtccctggtcaactgcaagcgaccccgcgat
ttagtacgctgtccgcatcgtcaagcggatatcattcactcgacatttcccttccaaactctccctttatgactcataac
aagtcgacacagacccccagtccgtctaatcatcttgtttgcatttatttgagctcagtaacgcggacgctgtcgatgct
gccggacatgcggccagagatgctggtcgcacgagagctgcggcgcatcggtgacaagttcaatgatatctacataaatg
gggtgagtatcctactctgtcctcactgtcctcttcggccaactgctatgggccaaggggcaacactgactccttaccct
ggggacaacaagaacaaagagtcacccctaagatccagatcttcctggctccatgttagaatgggggaagtggagcaaca
ggaaatagtatga
© 1998-2019