Dataset for CDS BAD of organism Paramormyrops kingsleyae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3QX41_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BAD (length=510 residues).
atgtcgggtgtcaccatggcgcacatgtttaccatctccggcaatgagtcggacacttctgaatccgacacaccagatgt
cacagcaaattcacagcttggaaataacctcaaaaatacgaaaaatccaggagaggctggaggtcgtgtacggatgcggt
ccgaatcccaggtttcttcgattcgaagcgaggatctcgattttggtgaaggaggtgcatctgaggagggcggaggcgtg
tgccccggggatggcactccttttcgaggacgctcgcggtcagccccgcccgcgctgtgggcagcacagcggtatggacg
acagctgcggcgtatgagtgacgagtttgacaccctgctggacaaagggatgaagagggtgcgcagtgccggggctgccc
gacagatgcaggcgtcccccagctggttcgcctttctctggagccacaaggagagcgacgcggagatcagcggaagcttg
tcgaccgccgacagcagagctgcacagtga
© 1998-2019