Dataset for CDS PMAIP1 of organism Papio anubis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcagctgcatttcaccagaagcaaaaagctcgtctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
catagggggactccaaaagagactttttctcaggagatgcacacttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
© 1998-2018