Dataset for CDS Unclassified of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5P3K2_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ovis aries (length=129 residues).
atgtggcggcggcgcgcgcggggcgggggggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggc
cgcgcaggtggcggcgctggcggcctggctgctcggcaggcggaacttg
© 1998-2018