Dataset for CDS BMF of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5QFV1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ovis aries GN=BMF (length=567 residues).
ctcacaggggagatggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggagccagg
ggcccagcccaggaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctct
tccctctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagct
tccccgagccagggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccg
gctcccccttcctgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcag
agatacagattgcccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccga
aatcgcatgtggtggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaatggggcaggccc
caggtga
© 1998-2018