Dataset for CDS BIK of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5QCU2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ovis aries GN=BIK (length=444 residues).
atgtatcaagcaagacccctctctaggaacctctttttgtacaccttcctacaaaaccacggcccaggcttcctggatga
ccaaggctcagggcttcccggcgtgaccagtatcttggagttccaccccatctccccctacagtgacagtccacactacc
tggccatgcagctggcctccattgccgacgagatggagctgaggttgctgctgccccagttcgttgagcccttctggatg
cccatgtacagcttgtgtttcccctacagccacgtagggctcagggatgttctgagaagctttatggttgctttcaccaa
cctcagggagaaccgaaggctctggagcttcctgactctcagggaccgggtgtcgcccagcctgtggcccgagctggcac
tgtccctgctggtggtggcgatgctcagctgggggtgccgcttc
© 1998-2018