Dataset for CDS BAD of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5P8G9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ovis aries GN=BAD (length=540 residues).
caggggcctcgttatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccag
ccctgcagataggggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgg
gcctcctgggggaagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacc
cggagtcgtcacagctcctaccccgcggggccagaggatgacgaagggacggaggaggaggatctcggcccctttagggg
ccgctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttc
acgtctccttcaaggggcttcctcgcccgaagagcgcgggcacggcaacgcaaatgcgacaaagccctagctggacgcgc
ttcctccagtcctggttgagccggaacttggggagaggaggctccgccccctctcagtga
© 1998-2018