Dataset for CDS classical BH3-containing proteins of organism Otolemur garnettii

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|H0WVR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Otolemur garnettii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctcctcagataggggcctgggccccagcccctc
aggggaccagcccctaggccccggcaagaaccgctgcacgactccaagtctcctgggggacgccagtcacctgcaggggc
agccggccagcaacacccaccatggagcaggacctggggcagtggagacccggagtcgccacagctcgtacccggcaggg
acagaggaggatgaagggattgaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgaactccggaggatgagtgacgagttcgaagactccttcaagaagggacttcctcgcccgaaga
gcgcaggcacagcgacacagatgcgacagagctccagctggacgcgtgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctgccagtga
>gnl|bcl2dbcds|H0WYH6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Otolemur garnettii GN=BMF (length=549 residues).
atggagccatcgcagtgtgtggaggaactggaggatgacgtgttccaaccagaggatggggagctggggactgggaatgt
gctctctgctgacctgtttgcccagagccagctggactgtccccttagccggcttcagctcttccctctcacccactgct
gtggccctgggctccgaccaaccagccaggaagacaaagccactcagaccctcagcccagcctccccaagccagggtgtc
atgctgccttgtggggtgactgaagaaccccagagactcttttatggtaatgttggctaccggcttcctctccctgccag
tttccctgcaggcttgcccattggggagcagccccctgaagggcaatggcaacatcgagcagaggtacagattgcccgaa
agcttcagtgcattgcagaccagtttcaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtggtggcag
gtcctctttttcctacacaacctggctttgaacggagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|H0XAE7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Otolemur garnettii GN=BIK (length=444 residues).
atgtcagcaggaaggccagtctccatggaccactttatggagaccttcccatttgagcagctcctggagcctctgacaat
ggaggttcttggcatgactgagcccaaccccatggagtgcctggaggacagtgaccaggtggccctgcggctagcctgca
ttggggacgagatggacctgcatctcaggagcccccgactagcccagctgtccaggatgaccatgcacagcctgggtcta
tcctacaaccagactgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacctcagggagaatatagcagg
gttctggagatccctgagccgcgggccctgggtgtgccctgccccggcgtgggaacaggtgctgttgctgctgttgttgc
tggtgctgctgctggcagggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|H0XQ00_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Otolemur garnettii GN=BBC3 (length=582 residues).
atggcccgcgcacgccaagagggcagctccccggagcccgtagagggcctggctcgcgacggtccgcgccccttcccgct
cggccgcctagtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgccgccccggctctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccaccctagggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcctggatggtcctcagccatcactcttgccggccgagcagcacctggagtcgcc
cgttcccagcaccccgggggccctggcgggcggtcccacccaggcggccccggaggtccggggggaggaggagcagtggg
ccagagagataggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagagtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|H0XW23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttcagatgtaggttctgagtgtgaccgagaaggtggacaattgcaacctgcggagagacctcccca
gctcaggcctggggcccctacctctctacatacagagccccaaggtaatcccgaaggcaatccggaagtcgaaggggacc
gctgcccccaaggcagccctcagggcccactggccccaccggccagccctggtccttttgctaccagatccccgcttttc
atctttgtaagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcagtctcaggccgaacctgcagatttgcgcccggagatgtggatcgcccaagagttgcggcgtattggagacgag
tttaacgcttactacccaacgagggtatttttgcataattaccaagcagccgaagaccaccctcaaatggttatattacg
actgttgcgttacatcgtccgcctggtgtggaggctgcactga
>gnl|bcl2dbcds|H0Y001_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Otolemur garnettii GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtctgggtctgcgctc
gtctgccgcgcagctcacagctgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgctgccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018