Dataset for CDS BMF of organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0WYH6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Otolemur garnettii GN=BMF (length=549 residues).
atggagccatcgcagtgtgtggaggaactggaggatgacgtgttccaaccagaggatggggagctggggactgggaatgt
gctctctgctgacctgtttgcccagagccagctggactgtccccttagccggcttcagctcttccctctcacccactgct
gtggccctgggctccgaccaaccagccaggaagacaaagccactcagaccctcagcccagcctccccaagccagggtgtc
atgctgccttgtggggtgactgaagaaccccagagactcttttatggtaatgttggctaccggcttcctctccctgccag
tttccctgcaggcttgcccattggggagcagccccctgaagggcaatggcaacatcgagcagaggtacagattgcccgaa
agcttcagtgcattgcagaccagtttcaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtggtggcag
gtcctctttttcctacacaacctggctttgaacggagaagagaacaggaatggggcaggtcccaggtga
© 1998-2019