Dataset for CDS BIK of organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0XAE7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Otolemur garnettii GN=BIK (length=444 residues).
atgtcagcaggaaggccagtctccatggaccactttatggagaccttcccatttgagcagctcctggagcctctgacaat
ggaggttcttggcatgactgagcccaaccccatggagtgcctggaggacagtgaccaggtggccctgcggctagcctgca
ttggggacgagatggacctgcatctcaggagcccccgactagcccagctgtccaggatgaccatgcacagcctgggtcta
tcctacaaccagactgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacctcagggagaatatagcagg
gttctggagatccctgagccgcgggccctgggtgtgccctgccccggcgtgggaacaggtgctgttgctgctgttgttgc
tggtgctgctgctggcagggggcctgcacctgctgctcaagtga
© 1998-2018