Dataset for CDS BCL2L11 of organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0XW23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttcagatgtaggttctgagtgtgaccgagaaggtggacaattgcaacctgcggagagacctcccca
gctcaggcctggggcccctacctctctacatacagagccccaaggtaatcccgaaggcaatccggaagtcgaaggggacc
gctgcccccaaggcagccctcagggcccactggccccaccggccagccctggtccttttgctaccagatccccgcttttc
atctttgtaagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcagtctcaggccgaacctgcagatttgcgcccggagatgtggatcgcccaagagttgcggcgtattggagacgag
tttaacgcttactacccaacgagggtatttttgcataattaccaagcagccgaagaccaccctcaaatggttatattacg
actgttgcgttacatcgtccgcctggtgtggaggctgcactga
© 1998-2018