Dataset for CDS BMF of organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A3B3I0V9_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3B3I0V9_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=510 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggcaatctgtcgtgagtgactga
>gnl|bcl2dbcds|A0A3B3I0V9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3B3I0V9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3P9JM16_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3P9JM16_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3P9JM16_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
© 1998-2019