Dataset for CDS BAD of organism Oryzias latipes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3HDU2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=495 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggctctgtgggccgccaaaaagtacggtcagcagct
ccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagtaa
© 1998-2019