Dataset for CDS HRK of organism Oryctolagus cuniculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1T7W1_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Oryctolagus cuniculus GN=HRK (length=273 residues).
atgtgcccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctggggctgcgctc
ggccgccgcgcagctcaccgccgcccggctcaaggcactcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttg
© 1998-2018