Dataset for CDS BAD of organism Oryctolagus cuniculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1SS60_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAD (length=342 residues).
ccgcgccccaaacccctctccgcaggcgccggagctatggaaacccggagccgccacagctcgtaccctgcggacgcgga
cgacagcgaaggggccgaggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggctgcac
agcgctacggccgcgagctccgaaggatgagcgacgagttcgagggctccgtcaagaagggactgcctcgcccgaagagc
gcgggcacagcgatgcagatgagggaaagctccagctggacgcgcgtcatccagtcttggtgggatcgcaatttggggaa
aggaggctccgccccttcccag
© 1998-2018