Dataset for CDS PMAIP1 of organism Nomascus leucogenys

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2I3HX97_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Nomascus leucogenys GN=PMAIP1 (length=162 residues).
aagcctgggagagcgcgcaggaacgctcaaccgagccccgcgccggctccagcagagctggaagttgagtgtgctactca
actcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacct
ga
© 1998-2018