Dataset for CDS BAD of organism Nomascus leucogenys

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2I3H4B2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Nomascus leucogenys GN=BAD (length=249 residues).
atgggggaggagcccagcccttttcgcggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcaacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccc
tcccagtga
© 1998-2018