Dataset for CDS classical BH3-containing proteins of organism Neolamprologus brichardi

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q4G1I4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Neolamprologus brichardi GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
cggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaacgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q4GGN3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neolamprologus brichardi GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagagacatcagaggaggtaggggaaggagaaaaccaacagtcagc
aagacaagttcaagaaagcaagccccagacgctctcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
© 1998-2019