Dataset for CDS classical BH3-containing proteins of organism Myotis lucifugus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|G1P8C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Myotis lucifugus GN=BAD (length=525 residues).
cctacagcccagagcatgttccagatcccagagtttgagcacagtgagcaggaagactccagccctgcagataggggcct
gggcccctgccccacaggggaccagcccccaggcctcaacaagcactggagtacggtcccaggtctcctgggggaagctg
gtcaccagcagggccagccggccagcagcagccaccatgacggcgctgggtctgtggagccgcggagtcgccacagctcg
taccccacggggaccgaggaggatgacgacaccgaggagggggagcccagccccttccgcggccgctcgcgttcagcgcc
cccaaacctctgggcagcacagcgctacggccgcgagctccggaggatgagcgacgagttccagggctcctttaagaagg
gtctccctcgcccgaagagcgctggcacagcaacgcagatgtggcaaaagtccagctggacgcgctttttccagtcctgg
tgggatcggaactcggggagaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|G1P8F9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Myotis lucifugus GN=PMAIP1 (length=165 residues).
atgcccgggaagaaggcgcgtaagaacgcgcagcctagcccgacgcgggccccggcagaggctgaaattgagtgtgccct
tcaattaaggagaattggagacaagctgagtttcctgcagaaacttctgaatctgatgtacaaactctttggctcaggaa
cctga
>gnl|bcl2dbcds|G1PAU1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Myotis lucifugus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgtttcagccagaggatgagctggggacccagcctgggag
tttgccctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacccact
gctgtggccctgggcttcgacccatcagccaggaagacaaggccacccagaccctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cagtttccctgcaggctcgccccttggtgagcagcccccggaaggacagtggcaacatcatcgagcagagatccagatcg
ccagaaagcttcagagtattgccgaccaatttcatcggcttcaaatgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcagttcctcctcttcctacataacctcgccttgaatggagatgagaacaggaacggggccggtcccaggtga
>gnl|bcl2dbcds|G1PDJ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L11 (length=210 residues).
tccatgcagcagtctcaggccctacctgtagacatgcgtccggagatgtggatcgctcaggagctgcggcggatcgggga
cgagttcaacaactcctaccgcaacccacggagggactttctgaatgtttaccgggaagcagaaggccacccccagatgg
tggtcttacgactgttgcgttacatcctccgtctggtgtggaggaggatg
© 1998-2018