Dataset for CDS BMF of organism Myotis lucifugus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1PAU1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Myotis lucifugus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgtttcagccagaggatgagctggggacccagcctgggag
tttgccctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacccact
gctgtggccctgggcttcgacccatcagccaggaagacaaggccacccagaccctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cagtttccctgcaggctcgccccttggtgagcagcccccggaaggacagtggcaacatcatcgagcagagatccagatcg
ccagaaagcttcagagtattgccgaccaatttcatcggcttcaaatgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcagttcctcctcttcctacataacctcgccttgaatggagatgagaacaggaacggggccggtcccaggtga
© 1998-2018