Dataset for CDS BCL2L11 of organism Mustela putorius furo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M3YDI3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L11 (length=699 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccggacggctcgcgg
cggcgggcgggctgccagtggccggctctgcgctgccccgggggctctgaaggcgagtcccaggctttgtctcccgcgct
tctttcgtgctgagggtcagggagctccgggtcggcgaaggacgcgagcgggacgccgcggggctcgggcccggacgcga
cggtcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgaccgaga
aggtggacaattgcagcctgttgagaggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaag
acaggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
agtgcaatggcttccaggaggcagtctcaggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcg
gcgtattggagacgagtttaatgcgtattacccaaggagggtctttttgaataattacccagcagccgaagcccaccccc
aaatgattatcttacgactgttacgttacatcatccgcctggtgtggagattacagtga
© 1998-2018