Dataset for CDS HRK of organism Mus musculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|P62816_HRK-03 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mus musculus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
© 1998-2018