Dataset for CDS BIK of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|O70337_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|O70337_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|O70337_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=429 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggg
>gnl|bcl2dbcds|O70337_BIK-04 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=321 residues).
atgttcaccagaaaccaggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccgatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
© 1998-2018