Dataset for CDS BCL2L11 of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|O54918_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=276 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatcagttggagaatcttaaccaagtg
gcacaaaatatccacggtgatgcctggtacaactga
>gnl|bcl2dbcds|O54918_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaact
tacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctt
tatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctcaggaggaa
cctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaag
gagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttcc
gtctggtatggagaaggcattga
© 1998-2018