Dataset for CDS BMF of organism Monopterus albus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3QZ16_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Monopterus albus GN=BMF (length=483 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtactgcattcagggagataaagtgtgaaga
ccggggcacacagacagctggccctaccctggcaccgaacaacagtatgctgccctgtggagttgcagaggatcccagac
cactcttctatggcaacgcaggttttcgattgcacttcccagcacactttgagcttgttggggatcaggaagcgaggcga
caagaggatcaaaacgggatggagcatctaccccggcagcaacgtgtggcgcgcagtgtggaggcctgtattggccagaa
actccagctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaaaccaaaggaaccaggggccgctgt
ggtggcgcctggccacaactctgctcagccttctgtttgatagggggttcattgctggaggaggcggagcgggacggagg
tga
>gnl|bcl2dbcds|A0A3Q3QZ16_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Monopterus albus GN=BMF (length=483 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtactgcattcagggagataaagtgtgaaga
ccggggcacacagacagctggccctaccctggcaccgaacaacagtatgctgccctgtggagttgcagaggatcccagac
cactcttctatggcaacgcaggttttcgattgcacttcccagcacactttgagcttgttggggatcaggaagcgaggcga
caagaggatcaaaacgggatggagcatctaccccggcagcaacgtgtggcgcgcagtgtggaggcctgtattggccagaa
actccagctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaaaccaaaggaaccaggggccgctgt
ggtggcgcctggccacaactctgctcagccttctgtttgatagggggttcattgctggaggaggcggagcgggacggagg
tga
© 1998-2019