Dataset for CDS HRK of organism Monodelphis domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7G1G0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Monodelphis domestica GN=HRK (length=294 residues).
atgtgcccgtgtcccctgcaccgcggtcgcggtcccccggcggtgtgcgcctgcagctcggaccgcctggaacagcgcgc
ggcggcggcagcacagctcacggccgcccgcctcaaggcgcttggggacgagctgcaggaacggaccatgtggaggcgcc
gggcgcggagtcggcgggccgcagcggaggcggccggcagcggcggcggcgggctccccgcctactgggcttggctgtgc
gcggccgctcatgtggcggcgctggcggcctggctgctccggaggagaaacttg
© 1998-2018