Dataset for CDS BMF of organism Monodelphis domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6X3N6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Monodelphis domestica GN=BMF (length=555 residues).
atggagcctcctcactatgtggaagagctagaggacgatgtgttccacccggaggactcagagcctggtgctcagccagg
gggcctgacctcagctgctctgtttgcccagagccagcctgactatatgctggatgggctgcagcttttccctcttactc
actgctgtggcccagggcttcggtcagttggccaggaagataaggccactcagactctcagtccagcatcccccagccaa
ggtgtcatgctgccttgtggagtgactgaagagccccaccgactcttttatggcaatgctggatatcgacttcccctccc
agccagttttcctgctagcctgcggcttggagaggagccccctgaagagcagtgggagcatcgagccgaggtgcagattg
cccaaaagcttcaatgcatagcggaccagttccatagactccacatgcagcggcaccagcagaaccgaaaccatgtgtgg
tggcaaatcctcctcttccttcacaacttggccttgaacagagaggagaacaggaatggggcaggccctaggtga
© 1998-2018