Dataset for CDS Unclassified of organism Mola mola

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q4AXL5_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Mola mola (length=438 residues).
atgccgtataaaaacaaaatagatacaagatctccatgtgactgcttccacgctgtgtttcccccaccgtcctgtgccgc
tggagccccagcgcaaataagccgttccgacaacggtggcgagcggcgctccagcggattcggagaaccggactcgccgt
cctggcgcgggatcattcccgtcgacagtctaggcgtgtttcagacgatatttcacctcccacgaagcctctccatcgga
tatttctccgccgacggtgactcgctgcctacctcgccgctctccccgaggccaccgacggctgacagagcgacacagac
tccgagcctcagcggccaggcgatgcaacacgccctgcagcgcatggccgggctgtgcggcggagaaccggggaccacgg
ggttaatccgacaaatgtgggatatacaaccgatgtag
© 1998-2019