Dataset for CDS classical BH3-containing proteins of organism Mesocricetus auratus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A1U7Q4V0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mesocricetus auratus GN=BAD (length=615 residues).
atgggaaccccaaaacagccctcgctggctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccgaagcct
ggggaacgacgcgggaggaaggcggcgaagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagactccaatactgcagataggggcctgggccctagcctcactggggacccaccaggtccctgcctggctccaggt
ctcctggggaacatcagacaccaacaggaacaggcagccaacagcagtcatcatggaggcactggggctatggagacccg
gagtcgccacagttcatacaccgcggggaacgaggaggatgaagggatggaagaggagctcagcccctttcggggccgct
cgcgttcggctccccccaatctctgggctgcgcagcgctacggccgcgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcagggactgcaacacagatgcgacaaagcgccagctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccactccctcccaatga
>gnl|bcl2dbcds|A0A1U7QLK6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mesocricetus auratus GN=PMAIP1 (length=318 residues).
atgctccagagcgtagcgcgtcagaacgcgccatcgaacccagcgcgggcagagctagcgcctgagttcatagctcaact
ccggaggattggagacaaactgtcttctgagtggtgtgaacccgacatcattgcggtgctggcggagatgcctggcaaga
aggctcgaaagagcgtgacgaggattccgagcccaacgcgggtcccaacagatgtggaagacgagtgtgttcatcaactc
cggaggattggagacaaacagaatttgcggcagaaacttctgaattttatttccaagctctttagtttagtaacctga
>gnl|bcl2dbcds|A0A1U7R468_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mesocricetus auratus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccacgggcctccggccgtgtgcggttgcggcgacactcgccccgggctgcgctg
ggcggcggcacaggtgaccgcgctgaggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgccgcgcgc
ggccccgggacccgctgcctgcgctgctgcccgcactccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|A0A1U7R5N5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mesocricetus auratus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttggcccgcgacagtccgcgccccttcccgct
cggccgcctggtgccctccgctgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccccgccctgc
tgccggccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccacgcccggacggtcctcagccctcgctgtcaccggcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggcggccccacccaagcagccccgggagtgcgcggggaggaggaggagtggg
cccgggagatcggggctcagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgcccgtcgccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=426 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatcttacagaag
gagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgcttcatcg
tccgactagtatggagaaggcattga
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=270 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggatctgtgtgagaatcttaagcacgag
tggcagattcatggtgatcaaagtaaaagt
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=594 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaaggtaatcctgacggtgaaggggaccgctgcccccacg
gcagcccgcagggcccgctggccccaccggccagccctggcccttctgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagtccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatct
tacagaaggagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacg
cttcatcgtccgactagtatggagaaggcattga
>gnl|bcl2dbcds|A0A1U8CPE0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=570 residues).
attttcccaggagagatggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagcc
agggacacaacctgggagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagc
tcttccctctcactcactgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagccca
gcctccccaagccagggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggcta
caggcttcctctccctgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgag
cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaac
cgagaccgtgcatggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtggg
tccctggtga
>gnl|bcl2dbcds|A0A1U8CPE0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagccagggacacaacctgg
gagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagctcttccctctcactc
actgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggctacaggcttcctctccc
tgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgagcagaggtacagatcg
ccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaaccgagaccgtgcatgg
tggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtgggtccctggtga
© 1998-2018