Dataset for CDS BMF of organism Mesocricetus auratus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A1U8CPE0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=570 residues).
attttcccaggagagatggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagcc
agggacacaacctgggagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagc
tcttccctctcactcactgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagccca
gcctccccaagccagggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggcta
caggcttcctctccctgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgag
cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaac
cgagaccgtgcatggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtggg
tccctggtga
>gnl|bcl2dbcds|A0A1U8CPE0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagccagggacacaacctgg
gagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagctcttccctctcactc
actgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggctacaggcttcctctccc
tgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgagcagaggtacagatcg
ccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaaccgagaccgtgcatgg
tggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtgggtccctggtga
© 1998-2018