Dataset for CDS BAD of organism Mesocricetus auratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1U7Q4V0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mesocricetus auratus GN=BAD (length=615 residues).
atgggaaccccaaaacagccctcgctggctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccgaagcct
ggggaacgacgcgggaggaaggcggcgaagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagactccaatactgcagataggggcctgggccctagcctcactggggacccaccaggtccctgcctggctccaggt
ctcctggggaacatcagacaccaacaggaacaggcagccaacagcagtcatcatggaggcactggggctatggagacccg
gagtcgccacagttcatacaccgcggggaacgaggaggatgaagggatggaagaggagctcagcccctttcggggccgct
cgcgttcggctccccccaatctctgggctgcgcagcgctacggccgcgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcagggactgcaacacagatgcgacaaagcgccagctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccactccctcccaatga
© 1998-2018