Dataset for CDS BMF of organism Meleagris gallopavo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1NHG8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagaggtga
© 1998-2018