Dataset for CDS BMF of organism Maylandia zebra

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P9DPJ5_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Maylandia zebra GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3P9DPJ5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Maylandia zebra GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
© 1998-2019