Dataset for CDS BMF of organism Mastacembelus armatus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3Q3LME3_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Mastacembelus armatus GN=BMF (length=504 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcgcaccacgttcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgaacttgttggggatcaggaagtgaggcaa
caagaaagagaagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtgcacagtgtggaggcgtgtat
tggccagaaactccagctgataggagaccaatttcaccgagaacacttgcaactgtatcatctaaaccaaaggaaccagg
ggctgctgtggtggcgcctggccacagctctgctcagcctactgtttgacagagggttcattgctggaggaggcagagca
ggacggagacctccatgcccttga
>gnl|bcl2dbcds|A0A3Q3LME3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mastacembelus armatus GN=BMF (length=465 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcgcaccacgttcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgaacttgttggggatcaggaagtgaggcaa
caagaaagagaagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtgcacagtgtggaggcgtgtat
tggccagaaactccagctgataggagaccaatttcaccgagaacacttgcaactgcaggttggctgggcgccagagacgt
caggcagtttgcctgtcttgttagcatgcctcaccttgataacaggagtgtggagagagggatga
>gnl|bcl2dbcds|A0A3Q3LME3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mastacembelus armatus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcgcaccacgttcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgaacttgttggggatcaggaagtgaggcaa
caagaaagagaagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtgcacagtgtggaggcgtgtat
tggccagaaactccagctgataggagaccaatttcaccgagaacacttgcaactgtatcatctaaaccaaaggaaccagg
ggctgctgtggtggcgcctggccacagctctgctcagcctactgtttgacagagggttcattgctggaggaggcagagca
ggacggaggtga
© 1998-2019