Dataset for CDS classical BH3-containing proteins of organism Mandrillus leucophaeus

[Download (right click)] [Alignment] [Repertoires]

18 sequence(s)

>gnl|bcl2dbcds|A0A2K5XJR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggggagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcaccgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
catgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5XSA1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mandrillus leucophaeus GN=BIK (length=471 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
cctggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5Z4C3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mandrillus leucophaeus GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5Z4C3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mandrillus leucophaeus GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgaatgcttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctagaggatataggtgat
agttcattgtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaacca
caaggatttctcatga
>gnl|bcl2dbcds|A0A2K5ZWH1_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcaactgcatttcaccagaggcaaaaagctcgtctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaaagagactttttctcaggaggtgcatacttcataaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K5ZWH1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
© 1998-2018