Dataset for CDS classical BH3-containing proteins of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

17 sequence(s)

>gnl|bcl2dbcds|A0A1D5QGJ8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca mulatta GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagcggggactgcagggacggcagg
gacggcgagggaccaggccggatttgggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcctcctccc
cacttgtccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttgg
agacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaac
ttgcataaggggactccaaaagagactttttctcaggaggtgcacacttcatcaatttgaagaaagattgcattgtaat
>gnl|bcl2dbcds|A0A1D5R1E4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Macaca mulatta GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|F7CM09_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|F7FFP6_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Macaca mulatta GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|F7GVS7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|F7GVS7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|F7GVS7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|F7GVS7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggtgagcgccggaccccctcccaggccgccccgcgccg
gtctgtcccttccttgtcccaaggcacgtccggatctgatgtcccacgatccctccccaacgccgtcctgccccttccta
gctccatag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|F7HHA9_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgttgcccaagctggagtgcactggtac
tatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=288 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgagtggttagcataa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
© 1998-2018