Dataset for CDS BMF of organism Macaca mulatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7CM09_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
© 1998-2018