Dataset for CDS BAD of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|F7GVS7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|F7GVS7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|F7GVS7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggtgagcgccggaccccctcccaggccgccccgcgccg
gtctgtcccttccttgtcccaaggcacgtccggatctgatgtcccacgatccctccccaacgccgtcctgccccttccta
gctccatag
>gnl|bcl2dbcds|F7GVS7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
© 1998-2018